Phenylacetyl-coa ligase

Author: gdrz

August undefined, 2024

http://eawag-bbd.ethz.ch/pac/pac_map.html Webkpu:KP1_2276 no KO assigned (GenBank) yniB; putative transmembrane protein kpu:KP1_2277 K10806 acyl-CoA thioesterase YciA [EC:3.1.2.-] (GenBank) yciA; putative enzyme kpu:KP1_2278 K19611 ferric enterobactin receptor (GenBank) iroN; TonB dependent outer membrane siderophore rece kpu:KP1_2279 K06190 intracellular …

Crp: Enterobacteriales

WebThe first step of this paa degradation pathway is catalysed by paaF-encoded phenylacetyl-coenzyme A ligases that produce phenylacetyl-coenzyme A. This metabolic intermediate, … Web1. feb 2024 · Also acts, more slowly, on acetate, propanoate and butanoate, but not on hydroxy derivatives of phenylacetate and related compounds. Formerly EC 6.2.1.21 bares 3b

(PDF) Characterization of a phenylacetate–CoA ligase

Web23. dec 2008 · The phl gene, encoding a PCL (phenylacetate–CoA ligase), was cloned in Escherichia coli as a maltose-binding protein fusion and the biochemical properties of the … Web2-Phenylethanol-d5. Phenylethyl alcohol-dsub>5sub>; Phenethyl alcohol-dsub>5sub>; Benzyl carbinol-dsub>5sub> Bacterial Virus Protease Antibiotic Infection; 2-Phenylethanol-d 5 is Web"Purification and biochemical characterization of phenylacetyl-CoA ligase from Pseudomonas putida. A specific enzyme for the catabolism of phenylacetic acid." J Biol … bares abando

phenylacetate-CoA ligase activity - Wikidata

Phenylacetyl-coa ligase

Catabolism of Phenylacetic Acid in Escherichia coli - Semantic …

Web31. máj 2011 · A novel phenylacetic acid (PAA)-induced CoA-ligase-encoding gene, designated as phlC, has been cloned from penicillin-producing fungus Penicillium … WebEP0835316A1 EP96923946A EP96923946A EP0835316A1 EP 0835316 A1 EP0835316 A1 EP 0835316A1 EP 96923946 A EP96923946 A EP 96923946A EP 96923946 A …

Did you know?

Web15. mar 2006 · The phenylacetyl-CoA ligase encoded by the phl gene is therefore involved in penicillin production, although a second aryl-CoA ligase appears to contribute partially to … Web2. okt 1998 · Purification and biochemical characterization of phenylacetyl-CoA ligase from Pseudomonas putida. A specific enzyme for the catabolism of phenylacetic acid. H. …

Web1) In this PhAc-CoA catabolon, phenylacetyl CoA ligase (PhAc CoA ligase) (EC6. 2. 1. 30) is a key enzyme because this enzyme catalyzed the ﬁrst step, the activation of PhAc to … WebLocus tag: b1398 Name: paaK Funciton: phenylacetyl-CoA ligase paaA-paaB-paaC-paaD-paaE-paaF-paaG-paaH-paaI-paaJ-paaK-97: 4.3: ATTTGTGATTTTACTTAACTAT: b1388-76: 3.6: TTGTGTAACTTTCATAAAACAA-45: 3.6: TGTTTTTAATTAATTCACGAAA: ... KPN_01474 Name: paaF Funciton: enoyl-CoA hydratase-isomerase Locus tag: KPN_01475 Name: …

WebGO:0047475 phenylacetate-CoA ligase activity; Reaction participants Show >> << Hide. Name help_outline 2-phenylacetate Identifier CHEBI:18401 (Beilstein: 3539899) ... Web21. jún 2011 · Phenylacetyl-CoA ligase was measured essentially as described earlier . In brief, the reaction mixture contained MgCl 2 (0.2 M, 12.5 µl), ATP (0.1 M, 50 µl), CoA (20 …

WebPhenylacetate-CoA ligase (PA-CoA ligase) catalyzes the first step in aromatic catabolism of phenylacetic acid (PA) into phenylacetyl-CoA (PA-CoA). Often located in a conserved …

Web1. mar 1993 · This website requires cookies, and the limited processing of your personal data in order to function. By using the site you are agreeing to this as outlined in our … bares 51 bogotaWeb12. dec 2024 · Based on the pathway described in E. coli and Pseudomonas by Teufel et al. , phenylalanine (Phe) is degraded to PAA, and the first step of the pathway is the … sut gmbh jenaWebIn enzymology, a phenylacetate—CoA ligase is an enzyme (EC 6.2.1.30) that catalyzes the chemical reaction. ATP + phenylacetate + CoA AMP + diphosphate + phenylacetyl-CoA. … bares abetxuko